Jump to content

Haplogroup I-M170

From Wikipedia, the free encyclopedia

This is an old revision of this page, as edited by 199.59.79.143 (talk) at 02:08, 24 June 2012 (Distribution). The present address (URL) is a permanent link to this revision, which may differ significantly from the current revision.

Haplogroup I
Possible time of origin25,000-30,000 years BP
Possible place of originEurope or Southwest Asia
AncestorIJ
DescendantsI1, I2
Defining mutationsM170, M258, P19, P38, P212, U179
Highest frequenciesBosnia and Herzegovina 65%, Bosnia 54%,[1] Herzegovina 71%[1]

In human genetics, Haplogroup I (the letter I, not the number 1) is a Y-chromosome DNA haplogroup, a subgroup of haplogroup IJ, itself a derivative of Haplogroup IJK. Y-DNA Haplogroup I is predominantly a European haplogroup today. It represents nearly one-fifth of the population of Europe. It can be found in the majority of present-day European populations. Haplogroup I Y-chromosomes have also been found among some populations of the Near East, the Caucasus, Northeast Africa and Central Siberia.

Origins

The TMRCA (time to most recent common ancestor) for the I clade was estimated by Karafet and colleagues in 2008 as 22.2 k.a. (22,200 years ago) with a confidence interval between 15.3-30.0 ka.,[2] placing the Haplogroup I founding event approximately contemporaneous with the Last Glacial Maximum (LGM) which lasted from 26.5 ka to 19 or 20 ka.[3]

The TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I they estimate time to STR variation as 24±7.1 ky and time to population divergence as 23±7.7 ky.[4] These estimates are consistent with those of Karafet 2008 cited above. However Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28.4±5.1 ky, though they calculate the STR variation age of I1 at only 8.1±1.5 kya.[5]

Some speculate the initial dispersion of this population corresponds to the diffusion of the Gravettian culture.[6] Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I experienced an independent population expansion immediately after the last glacial maximum.[4]

European LGM refuges, 20,000 years ago. The Thames was a minor river that joined the Rhine, in the southern North Sea basin at this time.
  Solutrean and Proto Solutrean Cultures
  Epi Gravettian Culture
.

Distribution

The following figures include all subclades. The greatest density of Haplogoup I is to be found in Bosnia and Herzegovina 65% (Bosnia 54%, Herzegovina 71%).[1] Other higher than average densities occur in the Caucasus: Darginians of Dagestan 58% (a "rival" study shows ~0%, however!) and Abkhazians 33%,[7] Croatia (mainland 38%,[1][8][9] Hvar 66%,[8] Korcula 54%[8]), Serbia (Serbs 48%[10]), 23.6% of German males carry the haplogroup I mutation,[11] (highest frequency in Northern Germany 37.5%[6]), Norway 40%,[9][12] Sardinia 37%[13] (42%[9]), Sweden (North 26%,[9] Gotland & Värmland 50%[14]), Denmark 39%,[9][15] Montenegro 38%,[10] Bosnian Serbs 41%[16] (36%[17]),[7] (a "rival" study shows ~0%, however!) Iceland 33%, and West Finland 41%, though the figure drops in East Finland to 20%[18]

Average densities occur in Macedonia 34%,[1] Bulgaria 28%,[19] Albania 25%,[20] Hungary 11%[6] 28%,[21] Netherlands 25%, England 20%, Romania 22%, Moldavia 48%,[9] in Buhuşi and Piatra Neamţ[22] and Poland 18-20%.[9]

Within Europe, several populations are distinguished by having a significantly lower frequency of Haplogroup I than the surrounding populations: Italy and Switzerland have lower levels than Germany and Sardinia, Iberia has a lower density than southern France and Normandy, Greece has a lower level than Albania and the Slavic peoples, while the Baltic-speaking Latvians have a lower level than the Finnic-speaking Estonians. In all these areas, Haplogroup I populations are small relative to the dominant haplogroups in Europe (R1b in Western Europe, R1a1 in Eastern Europe, and N in Northeastern Europe).

Subgroups

File:Haplogroup I.png
Haplogroup I Subclades Distribution


The subclades of Haplogroup I with their defining mutations:[23]

  • I-M170 ( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179)
    • I* Middle East, Caucasus, Europe.
    • I1-M253 (L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253,M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111) Typical of populations of Scandinavia and Northwest Europe, with a moderate distribution throughout Eastern Europe
      • I1* In Anatolia at 1%[24]
      • I1a-M21 (M21)
      • I1b-M227 (M227) Appears to be limited to a marginally low frequency of approximately 1% among Slavic and Uralic peoples of Eastern Europe; also detected in a single Lebanese man
        • I1b1-M72 (M72)
      • I1c-P259 (P259/M507)
      • I1d-L22 (L22/S142)
        • I1d*
        • I1d1-P109 (P109)
        • I1d2-L205 (L205)
        • I1d3-L287 (L287)
          • I1d3*
          • I1d3a (L258)
      • I1e (I211)
      • I1f (L338)
    • I2-M438 (L68, M438/P215/S31). For details on subclades see Haplogroup I2

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer..

I*-M170

The composite subclade I contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several haplogroup I*-M170 individuals who do not fall in known subclades, with some of the greatest Y-STR diversity, have significantly been found among the populations of Turkey (8/741), Adygea (2/138), and Iraq (1/176),even though as a whole Haplogroup I-M170 occurs at only very low frequencies among modern populations of the Middle East and Caucasus. This is consistent with the belief that the haplogroup first appeared in that region. Overall, the highest frequencies of Haplogroup I*-M170 appear to be found among the Andalusians (3/103), French (4/179), Slovenians (2/55), Tabassarans (1/30)[25] and the Saami (1/35). [1] The greatest figure so far for I* was among the Laks in Dagestan, at a rate of (3/21).[25]

I-M253

Density map of HG I1. The darkest areas approach only around 45% of the population.

Haplogroup I-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%.

Outside Fennoscandia, distribution of Haplogroup I-M253 is closely correlated with that of Haplogroup I-M436; but among Scandinavians (including both Germanic and Uralic peoples of the region) nearly all the Haplogroup I Y-chromosomes are I-M253. Another characteristic of the Scandinavian I-M253 Y-chromosomes is their rather low haplotype diversity (STR diversity): a greater variety of Haplogroup I-M253 Y-chromosomes has been found among the French and Italians, despite the much lower overall frequency of Haplogroup I-M253 among the modern French and Italian populations.

I-M438

File:HaplogroupI2.png
Distribution of HG I2a2 (M423) by region.
I-M423

Haplogroup I-M423 is the most frequent Y-chromosome Haplogroup I in Central and Eastern European populations, reaching its peak in the Western Balkans, most notably in Dalmatia (50-60%[1]) and Bosnia-Herzegovina (up to 71%,[17] avg. 40-50%[1]). A greater variance of this group has been found in Ireland and Great Britain, but overall frequency is very low (2-3%). Haplogroup I-M423 is virtually absent in Fennoscandia, Western and Southwestern Europe.

I-M26

Haplogroup I-M26 is notable for its strong presence in Sardinia. Haplogroup I comprises approximately 40% of all patrilines among the Sardinians, and I-M26 is the predominant type of I among them.

Haplogroup I-M26 is practically absent east of France and Italy.,[26] while it is found at low but significant frequencies outside of Sardinia in the Balearic Islands, Castile-León, the Basque Country, the Pyrenees, southern and western France, and parts of the Maghreb in North Africa, Great Britain, and Ireland. Haplogroup I-M26 appears to be the only subclade of Haplogroup I found among the Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile-León in Spain and Béarn in France than among the population of ethnic Basques[citation needed]. The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[26]

The distribution of M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.[26]

I-M436

The distribution of Haplogroup I-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I-M253; the lack of correlation between the distributions of I-M253 and I-M436 in Fennoscandia may be a result of Haplogroup I-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I-M436, namely I-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I-M253 and Haplogroup I-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples, although the punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles[27] including north-east Ireland.[28]

Haplogroup I-M436 also occurs among approximately 1% of Sardinians.

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

See also

References

  1. ^ a b c d e f g Pericić M, Lauc LB, Klarić IM; et al. (2005). "High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations". Mol. Biol. Evol. 22 (10): 1964–75. doi:10.1093/molbev/msi185. PMID 15944443. Fig. 3. — I1b* (xM26) frequency and variance surfaces ... {{cite journal}}: Explicit use of et al. in: |author= (help); External link in |quote= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  2. ^ Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.{{cite journal}}: CS1 maint: multiple names: authors list (link)
  3. ^ Clark PU, Dyke AS, Shakun JD; et al. (2009). "The Last Glacial Maximum". Science. 325 (5941): 710–4. doi:10.1126/science.1172873. PMID 19661421. Retrieved 2010-01-27. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  4. ^ a b Rootsi Siiri; et al. (2004). ", Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe". American Journal of Human Genetics. 75 (1): 128–137. doi:10.1086/422196. PMC 1181996. PMID 15162323. {{cite journal}}: Explicit use of et al. in: |author= (help)
  5. ^ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. pp. 33-42.
  6. ^ a b c Semino O, Passarino G, Oefner PJ; et al. (2000). "The genetic legacy of Paleolithic Homo sapiens sapiens in extant Europeans: a Y chromosome perspective". Science. 290 (5494): 1155–9. doi:10.1126/science.290.5494.1155. PMID 11073453. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  7. ^ a b Nasidze Ivan; et al. (2004). ", Mitochondrial DNA and Y-Chromosome Variation in the Caucasus". Annals of Human Genetics. 68 (Pt 3): 205–221. doi:10.1046/j.1529-8817.2004.00092.x. PMID 15180701. {{cite journal}}: Explicit use of et al. in: |author= (help)
  8. ^ a b c Barać L, Pericić M, Klarić IM; et al. (2003). "Y chromosomal heritage of Croatian population and its island isolates" (PDF). Eur. J. Hum. Genet. 11 (7): 535–42. doi:10.1038/sj.ejhg.5200992. PMID 12825075. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  9. ^ a b c d e f g Rootsi S, Magri C, Kivisild T; et al. (2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe". Am. J. Hum. Genet. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  10. ^ a b Mirabal S; Varljen T; Gayden T; et al. (2010). "Human Y-chromosome short tandem repeats: A tale of acculturation and migrations as mechanisms for the diffusion of agriculture in the Balkan Peninsula". American Journal of Physical Anthropology. 142 (3): 380–390. doi:10.1002/ajpa.21235. PMID 20091845. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  11. ^ http://vetinari.sitesled.com/poland.pdf
  12. ^ Passarino, Giuseppe; Cavalleri, Gianpiero L; Lin, Alice A; Cavalli-Sforza, LL; Børresen-Dale, AL; Underhill, PA (2002). "Different genetic components in the Norwegian population revealed by the analysis of mtDNA and Y chromosome polymorphisms". European Journal of Human Genetics. 10 (9): 521–529. doi:10.1038/sj.ejhg.5200834. PMID 12173029.
  13. ^ P. Francalacci, L. Morelli, P.A. Underhill et al., "Peopling of Three Mediterranean Islands (Corsica, Sardinia, and Sicily) Inferred by Y-Chromosome Biallelic Variability," American Journal of Physical Anthropology 121:270–279 (2003)
  14. ^ Karlsson, Andreas O; Wallerström, Thomas; Götherström, Anders; Holmlund, Gunilla (2006). "Y-chromosome diversity in Sweden – A long-time perspective". European Journal of Human Genetics. 14 (8): 963–970. doi:10.1038/sj.ejhg.5201651. PMID 16724001.
  15. ^ Sanchez, JJ; Borsting, C; Hallenberg, C; Buchard, A; Hernandez, A; Morling, N (2003). "Multiplex PCR and minisequencing of SNPs: a model with 35 Y chromosome SNPs". Forensic Science International. 137 (1): 74–84. doi:10.1016/S0379-0738(03)00299-8. PMID 14550618.
  16. ^ Battaglia, Vincenza; Fornarino, Simona; Al-Zahery, Nadia; Olivieri, Anna; Pala, Maria; Myres, Natalie M; King, Roy J; Rootsi, Siiri; Marjanovic, Damir (24 December 2008). "Y-chromosomal evidence of the cultural diffusion of agriculture in southeast Europe" (PDF). European Journal of Human Genetics. 17 (6): 820–30. doi:10.1038/ejhg.2008.249. PMC 2947100. PMID 19107149.
  17. ^ a b Marjanovic D, Fornarino S, Montagna S; et al. (2005). "The peopling of modern Bosnia-Herzegovina: Y-chromosome haplogroups in the three main ethnic groups". Ann. Hum. Genet. 69 (Pt 6): 757–63. doi:10.1111/j.1529-8817.2005.00190.x. PMID 16266413. {{cite journal}}: Explicit use of et al. in: |author= (help); Unknown parameter |month= ignored (help)CS1 maint: multiple names: authors list (link)
  18. ^ T. Lappalainen, V. Laitinen, E. Salmela et al., "Migration Waves to the Baltic Sea Region," Annals of Human Genetics (2008) doi:10.1111/j.1469-1809.2007.00429.x
  19. ^ Comptes rendus de l’Academie Bulgare des Sciences Tome 62, No3, 209, Y-chromosomal Haplogroups in Bulgarians, Sena Karachanak, Simona Fornarino, Viola Grugni, Ornella Semino, Draga Toncheva, Angel Galabov, Boris Atanasov (Submitted on December 22, 2008).
  20. ^ Y-STR variation in Albanian populations, Gianmarco Ferri & Sergio Tofanelli & Milena Alù & Luca Taglioli & Erjon Radheshi & Beatrice Corradini & Giorgio Paoli & Cristian Capelli & Giovanni Beduschi (2010)
  21. ^ Tambets, Kristiina; Rootsi, Siiri; Kivisild, Toomas; et al. "The Western and Eastern Roots of the Saami—the Story of Genetic 'Outliers' Told by Mitochondrial DNA and Y Chromosomes". American Journal of Human Genetics. 74 (661–682): 2004. {{cite journal}}: Explicit use of et al. in: |first3= (help)
  22. ^ Alexander Varzari (2006), "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms," Dissertation for the Faculty of Biology at Ludwig-Maximilians University, München.
  23. ^ ISOGG 2011
  24. ^ Cinniog˘lu, Cengiz et al 2003-04, Excavating Y-chromosome haplotype strata in Anatolia
  25. ^ a b Bulayeva, Caciagli et al, 2009.http://vigg.academia.edu/KazimaBulayeva/Papers/125870/The_key_role_of_patrilineal_inheritance_in_shaping_the_genetic_variation_of_Dagestan_highlanders
  26. ^ a b c Rootsi; et al. "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1" (PDF). {{cite web}}: Explicit use of et al. in: |last= (help)
  27. ^ De Beule, Hans (2010). "Early Bronze Age Origin and Late Iron Age (La Tène) Migrations of I-L38". The Russian Journal of Genetic Genealogy. 1 (2): 47–55. Retrieved 8 May 2011.
  28. ^ McEvoy and Bradley, Brian P and Daniel G (2010). Celtic from the West Chapter 5: Irish Genetics and Celts. Oxbow Books, Oxford, UK. p. 117. ISBN 978-1-84217-410-4.
Notes

Phylogenetic tree and distribution maps

Mailing Lists

Projects

Other