Haplogroup Q-M242
Haplogroup Q | |
---|---|
Possible time of origin | 17,000 to 22,000 years ago[1][2] |
Possible place of origin | Central Asia,[3] the Indian Subcontinent,[4] Siberia[5] |
Ancestor | P |
Descendants | Q1 (P36.2), Q* |
Defining mutations | M242 |
Highest frequencies | Indigenous Americans, Kets, and Selkups |
In human genetics, Haplogroup Q (M242) is a Y-chromosome DNA haplogroup.
Origins
Haplogroup Q is one of the two branches of haplogroup P (M45). Haplogroup Q is believed to have arisen in Central Asia or South Asia approximately 17,000 to 22,000 years ago.[6] It has had multiple origins proposed. Much of the conflict may be attributed to limited sample sizes and early definitions that used a combination of M242, P36.2, and MEH2 as defining mutations.
This haplogroup has many diverse haplotypes despite its low frequency among most populations outside of the Americas. There also are over a dozen subclades that have been sampled and identified in modern populations.
Technical specification of mutation
The technical details of M242 are:
- Nucleotide change: C to T
- Position (base pair): 180
- Total size (base pairs): 366
- Forward 5′→ 3′: aactcttgataaaccgtgctg
- Reverse 5′→ 3′: tccaatctcaattcatgcctc
Subclades
In Y-chromosome phylogenetics, subclades are the branches of haplogroups. These subclades are also defined by single nucleotide polymorphisms (SNPs) or unique event polymorphisms (UEPs). Haplogroup Q, according to the most recent available phylogenetics has between 15 and 21 subclades. The scientific understanding of these subclades has changed rapidly. Many key SNPs and corresponding subclades were unknown to researchers at the time of publication are excluded from even recent research. This makes understanding the meaning of individual migration paths challenging.
Haplogroup and Subclade Defining SNPs
Academic Name | RS ID | Position | Change | YCC 2008 rev | ISOGG 2008 | Parent Clade | Publications | Notes |
---|---|---|---|---|---|---|---|---|
P48 | - | 13006660-13006661 | –>T | Q1a4 | Q1a4 | MEH2 | This is now considered a private SNP. The positive sample from Karafet 2008 was retested at the Family Tree DNA GRC and was found to be negative. | |
L57 | rs34864948 | 14083496 | A/G | - | - | P36.2 | ||
L191 | - | 2947379 | A>del | - | - | L53, L54, L55, L213, L331, L475, L476 | The L191 SNP has been observed in several paternal lineages which are thought to have originated in northern Mexico. | |
L213 | rs34549365 | 8295033 | C>G | - | - | L56, L57, L528, M346 | ||
L245 | - | 5735090 | C>G | - | - | M378, L214, L215 | ||
M346 | - | 2947156 | C>G | Q1a3 | Q1a3 | MEH2 | ||
L215 | rs34601266 | 13399368 | C>T | - | - | P36.2 | ||
L55 | rs35768544 | 17922729 | G>A | - | - | L56, L57, L528, M346 | ||
L53 | rs34724285 | 20101684 | G>A | - | - | L56, L57, L528, M346 | ||
L54 | rs34954951 | 21702170 | G>A | - | - | L56, L57, L528, M346 | ||
L232 | - | 16025489 | G>A | - | - | M242 | The SNP was found during WTY testing at the Family Tree DNA GRC. | |
L56 | rs34703625 | 8208869 | G>A | - | - | P36.2 | ||
P36.2 | - | 13006449 | G>T | Q1 | Q1 | M242 | ||
MEH2 | rs4252209 | 4985637 | G>T | Q1a | Q1a | P36.2 | ||
L214 | rs34694026 | 20365995 | T>C | - | - | P36.2 | ||
M3 | rs3894 | 17605757 | C>T | Q1a3a | Q1a3a | L53, L54, L55 | The M3 SNP defines the dominant Y-DNA subclade of Haplogroup Q for the indigenous people of the Americas. This SNP is geographically widespread, occurring from the northeast tip of Siberia and throughout North America, the Caribbean, Central America, and South America. | |
M194 | rs2032677 | 13523944 | T>C | Q1a3a2 | Q1a3a2 | M3 | ||
P292 | rs13447374 | 13540161 | –>G | Q1a3a3 | Q1a3a3 | M3 | ||
P106 | - | 13932316 | G>A | Q1a3a3 | Q1a3a3 | M3 | ||
M19 | rs3910 | 20192619 | T>A | Q1a3a1 | Q1a3a1 | M3 | ||
M199 | rs2032589 | 13540505-13540504 | –>G | Q1a3a3 | Q1a3a3 | M3 | ||
M323 | rs13447377 | 20327106 | C>T | Q1a6 | Q1a6 | M346 | ||
P89.1 | - | 13359859 | G>T | Q1a5 | Q1a5 | MEH2 | Limited research indicates that this may be a private SNP. The P89 mutation is also found in R1b. | |
M265, N14 | rs3212294 | 13540044 | C>A | Q1a1 | Q1a1 | MEH2 | ||
M242 | rs8179021 | 13527976 | C>T | Q | Q | P SNPs | ||
M378 | - | 13536901 | A>G | Q1b | Q1b | P36.2 | ||
M25 | - | 20326052 | G>C | Q1a2 | Q1a2 | P36.2 | ||
M143 | - | 20349206 | G>T | Q1a2 | Q1a2 | P36.2 | ||
M120 | - | 20366782 | T>C | Q1a1 | Q1a1 | P36.2 |
Phylogenetic Variants
The subclade proposed by Sharma 2007 (SS4bp, rs41352448) is not represented in any current trees because it is a value for the STR DYS435 with a value of 12.[4] Karafet 2008, dismissed it as unsuitable by not including it on the Y-Chromosome Consortium tree.[6] It has also been determined to be unsuitable for inclusion on the ISOGG Y-DNA tree.[7] Further, analysis of STR based haplotypes from Sharma 2007 indicates that the DYS435=12 variant, using online haplogroup prediction tools, may occur in multiple branches of the Q tree.
Phylogenetic Trees
There are several confirmed and proposed phylogenetic trees available for haplogroup Q. The scientifically accepted one is the Y-Chromosome Consortium (YCC) one published in Karafet 2008 and subsequently updated. A draft tree that shows emerging science is provided by Thomas Krahn at the Genomic Research Center in Houston, Texas. The International Society of Genetic Genealogy (ISOGG) also provides an amateur tree.
The Genomic Research Center Draft Tree
This is Thomas Krahn at the Genomic Research Center's Draft tree Proposed Tree for haplogroup Q.
- P
- Q M242
- P36.2, L232, L273, L274
- MEH2, L472, L528
- M120, N14, M265
- M25, M143
- L697.2, L712, L713, L714, L715, L716, M365.3
- M346, L56, L57, L474
- L53, L54, L55, L213, L331
- M3, L892
- M19
- M194
- M199, P106, P292
- PAGES00104, PAGES00126
- PAGES00131
- L663
- SA01
- L766, L767
- L883, L884, L885, L886, L887
- L888, L889, L890, L891
- L191
- L330, L334
- L329, L332, L333
- L400, L401
- L456
- L568, L569, L570, L571
- L567
- L619.1
- L804, L805
- L807
- M3, L892
- M323
- L527, L529, L639
- L717, L718
- L53, L54, L55, L213, L331
- P89.1
- L275, L314
- M378, L214, L215
- L245
- L272.1
- L315
- L619.2
- L301
- L327
- L245
- M378, L214, L215
- MEH2, L472, L528
- P36.2, L232, L273, L274
- Q M242
The Y-Chromosome Consortium tree
This is the official scientific tree produced by the Y-Chromosome Consortium (YCC). The last major update was in 2008.[6] Subsequent updates have been quarterly and biannual. The current version is a revision of the 2010 update.[8]
- P
- Q M242
- Q1 P36.2
- Q1a MEH2
- Q1a1 M120, N14, M265
- Q1a2 M25, M143
- Q1a3 L213, L53, L54, L55
- Q1a3a L56, L57, M346
- Q1a3a1 M3
- Q1a3a1a M19
- Q1a3a1b M194
- Q1a3a1c M199, P106, P292
- Q1a3a2 L191
- Q1a3a1 M3
- Q1a3b M323
- Q1a3a L56, L57, M346
- Q1a4 P89.1
- Q1b L275
- Q1b1 L214, L215, M378
- Q1b1a L272.1
- Q1b1 L214, L215, M378
- Q1a MEH2
- Q1 P36.2
- Q M242
The 2011 ISOGG Tree
The subclades of Haplogroup Q with their defining mutation(s), according to the 2011 ISOGG tree are provided below.
- Q M242
- Q1 P36.2, L232, L273, L274
- Q1a MEH2
- Q1b L275, L314
- Q1b1 M378/Page100, L214, L215/Page82
- Q1b1a L245
- Q1b1a1 L272.1
- Q1b1a L245
- Q1b1 M378/Page100, L214, L215/Page82
- Q1 P36.2, L232, L273, L274
Distribution
Haplogroup Q may be one of the most widely distributed Y-chromosome lineages in the modern world. It is found in the Americas, North Africa, East Asia, South Asia, West Asia, and in Europe.
The Americas
Haplogroup Q is the predominant Y-chromosome haplogroup in indigenous peoples of the Americas.
Approximately 20,000 to 15,000 years ago, a group migrated from Asia into the Americas by crossing the Bering Strait.[2] Many of the men in this group must have belonged to haplogroup Q for it now accounts for the majority of non-European haplogroups in indigenous peoples of the Americas.
Indeed, haplogroup Q has been found in approximately 94% of Indigenous peoples of South America[9] and detected in Na-Dené speakers at a rate of 25-50%, and North American Eskimo–Aleut populations at about 46%.[10]
In more modern population groups from the Americas, all Q samples tested for M346 have been positive. This founding population spread throughout the Americas. In the Americas, a member of the founding population underwent a mutation, producing its descendant population defined by the M3 single nucleotide polymorphism (SNP).[2] Many members of haplogroup Q in the Americas belong to the Q-M3 subclade.[5]
However, a 4000-year-old Saqqaq individual belonging to Q-MEH2 haplogroup has been documented.[11]
Asia
Likely due to its origin in Central Asia, haplogroup Q may be found throughout Asia.[2] It has been reported that Q is found in the Altai people,[12] India,[13] Tibet,[14] Pakistan,[13] China,[15][16] Mongolia,[17] Tuvans,[18] and Uyghurs.[17] It is found at a frequency of more than 50% in the Pasthuns in Kabul the Capital of Afghanistan [1]
East Asia
To the east, haplogroup Q has been found in approximately 4% of Southern Altaians and 32% of Northern Altaians.[12] It is found in 16% of Tuvans.[18]
The frequency of Q in northern China is about 4%, with many Chinese samples of haplogroup Q belonging to the subclade Q-M120.[15][16] Haplogroup Q is found in approximately 3% of males in Tibet[14] and Mongolia.[17] It is also found in 3% of Uyghurs.[17]
The highest frequencies of Q in Asia are found among the Selkups (~70%) and Kets (~95%), they live in western and middle Siberia and their populations are small in number, being just under 5,000 and 1,500, respectively.
South Asia
Some examples of Q* (negative for known subclades) have been reported in the Indian subcontinent in low frequency.[4] The same studies have found Q-M346* (negative for known subclades) restricted to the Indian subcontinent. The most plausible explanation for these observations could be an ancestral migration of individuals bearing ancestral lineage Q* to the Indian subcontinent followed by an autochthonous differentiation to Q-M346. However, these are from studies where all current branches of the Q tree have not been tested.
The problematic phylogeny sampling of early studies has been demonstrated by subsequent studies that have found Q-M346, Q-M378, and Q-M25 in South Asia.
West Asia
Two studies conducted Ivan Nasidze in 2004 and 2009, show that the frequency of Q in Iran, varies between approximately 2% to 6%, depending on region. Iranian samples of haplogroup Q belong primarily to the subclade Q-M25.[19]
In Pakistan, at the eastern end of the Iranian plateau, the frequency of haplogroup Q is about 2.2% (14/638)[20] or 3.4% (6/176).[21]
Approximately 2.5% of males in Saudi Arabia belong to haplogroup Q.[22]
According to Behar et al. 5% of Ashkenazi males belong to haplogroup Q.[23] This has subsequently been found to be entirely the Q-M378 subclade and may be restricted to Q-L245.
Haplogroup Q has also been found in Algerians, Arabians, Syrians, Lebanese[24] and the United Arab Emirates.,[25]
Approximately 2% of males in Turkey,[26] In a study by Gokcumen it was found that among Turks that belong to the Afshar tribe haplogroup Q is seen with a prevalence of 13%.[27] Further, the Q-M25 subclade has been found in Turkey[26]
Q-M346 is found among the Khanty.[28]
Europe
The frequency of haplogroup Q in Norway and Sweden is about 3%, while 2.5% of Slovak males are in haplogroup Q.
Population Frequencies from Studies
Population | Paper | N | Percentage | SNPs Tested | |
---|---|---|---|---|---|
Austro-Asiatic (Khasi-Khmuic) | Reddy 2009 | 353 | 5.40 | P-M45(xM173) § | |
Austro-Asiatic (Mundari) | Reddy 2009 | 64 | 10.90 | P-M45(xM173) § | |
Nicobarese (Mon-Khmer) | Reddy 2009 | 11 | 0.00 | P-M45(xM173) § | |
Austro-Asiatic (Southeast Asia) | Reddy 2009 | 257 | 1.60 | P-M45(xM173) § | |
Garo (Tibeto-Burman) | Reddy 2009 | 71 | 1.40 | P-M45(xM173) § | |
Tibeto-Burman (India) | Reddy 2009 | 226 | 3.10 | P-M45(xM173) § | |
Tibeto-Burman (East Asia) | Reddy 2009 | 214 | 0.00 | P-M45(xM173) § | |
Indo-European (Eastern India) | Reddy 2009 | 54 | 18.50 | P-M45(xM173) § | |
Southern Talysh | Iran | Nasidze 2009 | 50 | 4.00 | P-M45(xM124,xM173) |
Northern Talysh | Azerbaijan | Nasidze 2009 | 40 | 5.00 | P-M45(xM124,xM173) |
Mazandarana | Iran | Nasidze 2009 | 50 | 4.00 | P-M45(xM124,xM173) |
Gilakia | Iran | Nasidze 2009 | 50 | 0.00 | P-M45(xM124,xM173) |
Iranians (Tehran) | Iran | Nasidze 2004 | 80 | 4.00 | P-M45(xM124,xM173) |
Iranians (Isfahan) | Iran | Nasidze 2004 | 50 | 6.00 | P-M45(xM124,xM173) |
Bakhtiari | Iran | Nasidze 2008 | 53 | 2.00 | P-M45(xM124,xM173) |
Iranian Arabs | Iran | Nasidze 2008 | 47 | 2.00 | P-M45(xM124,xM173) |
North Iran | Iran | Regueiro 2006 | 33 | 9.00 | P-M45(xM124,xM173) |
South Iran | Iran | Regueiro 2006 | 117 | 3.00 | P-M45(xM124,xM173) |
Georgians | South Caucacus | Nasidze and Stoneking 2001 | 77 | 3.00 | P-M45(xM124,xM173) |
Armenians | South Caucacus | Nasidze and Stoneking 2001 | 100 | 2.00 | P-M45(xM124,xM173) |
Azerbaijanis | South Caucacus | Nasidze and Stoneking 2001 | 72 | 0.00 | P-M45(xM124,xM173) |
§ These may include members of haplogroup R2.
Subclade Distribution
- Q (M242)
- Q* — Found with low frequency in India and Pakistan.[13] Important in Afghanistan, paragroup Q-M242 (xMEH2,xM378) was found at 16.3% in Pashtun people.[29]
- Q1 (P36.2)
- Q1a (MEH2)
- Q1a* Was found in Koryaks (at 10.3%), although the level of STR diversity associated with Q1a*-MEH2 is very low, this lineage appears to be closest to the extinct Palaeo-Eskimo individuals belonging to the Saqqaq culture arisen in the New World Arctic about 5.5 Ka.[30]
- Q1a1 (M120, M265/N14) — It is so far restricted to East Asia. It has been found at low frequency among Han Chinese,[15][16] Dungans,[31] Japanese,[32] Koreans,[31] and Tibetans.[14][16] Although it was reported in the Hazaras,[21] it was subsequently shown to be a lab error as demonstrated by the phylogenetic tree changes in Karafet 2008.
- Q1a2 (M25, M143) — Found with low to moderate frequency in Iran,[19] Lebanon,[33] and Turkey[26]
- Q1a3 (L56, L57, M346) — Found at low frequency in Europe, South Asia and West Asia. Including its Q-M3 subclade, it is the only branch of haplogroup Q found in modern indigenous populations of the Americas. It has been found in Pakistan,[21] Saudi Arabia,[22] the United Arab Emirates,[25] India [21] and Tibet.[14]
- Q1a3a (L53, L54, L55, L213)
- Q1a3a1 (M3) — Common in indigenous peoples of the Americas[5]
- Q1a3a1a (M19) — Found among some indigenous peoples of South America, such as the Ticuna and the Wayuu[34]
- Q1a3a1b (M194) — In South America
- Q1a3a1c (M199, P106, P292) — In South America
- Q1a3a1 (M3) — Common in indigenous peoples of the Americas[5]
- Q1a3b (M323) — It has been detected in Yemenite Jews.[35]
- Q1a3a (L53, L54, L55, L213)
- Q1b (L275, L314)
- Q1b1 (M378) — It is widely distributed in Europe, South Asia, and West Asia. It is found among samples of Hazaras and Sindhis.[21] It is also found in the Uyghurs of North-Western China in two separate groups.[36] The Q-M378 subclade and specifically its Q-L245 subbranch is speculated to be the branch to which Q-M242 men in Jewish Diaspora populations belong.[23][37] Although published articles have not tested for M378 in Jewish populations, genetic genealogists from the Ashkenazi, Mizrachi, and Sephardi Jewish populations have tested positive for both M378 and L245.
- Q1a (MEH2)
See also
- Populations
- Genetics
- Subclades
External links
- Q Y-Haplogroup Project at FTDNA
- American Indian Q3 project at FTDNA
- Spread of Haplogroup Q, from The Genographic Project, National Geographic
- The India Genealogical DNA Project
- British Isles DNA Project
References
Citations
- ^ Fagundes, Nelson J.R. (2008). "Mitochondrial Population Genomics Supports a Single Pre-Clovis Origin with a Coastal Route for the Peopling of the Americas" (pdf). American Journal of Human Genetics. 82 (3): 583–592. doi:10.1016/j.ajhg.2007.11.013. PMC 2427228. PMID 18313026. Retrieved 2009-11-19.
Since the first studies, it has been found that extant Native American populations exhibit almost exclusively five "mtDNA haplogroups" (A–D and X)6 classified in the autochthonous haplogroups A2, B2, C1, D1, and X2a.7 Haplogroups A–D are found all over the New World and are frequent in Asia, supporting a northeastern Asian origin of these lineages
{{cite journal}}
: Unknown parameter|coauthors=
ignored (|author=
suggested) (help) - ^ a b c d Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas" (PDF). Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095. Cite error: The named reference "Zegura" was defined multiple times with different content (see the help page).
- ^ Y-DNA Haplogroup Q and its Subclades - 2010
- ^ a b c Sharma S, Rai E, Bhat AK, Bhanwer AS, Bamezai RN (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evol. Biol. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.
{{cite journal}}
: CS1 maint: multiple names: authors list (link) CS1 maint: unflagged free DOI (link) - ^ a b c "Learn about Y-DNA Haplogroup Q" (Verbal tutorial possible). Wendy Tymchuk - Senior Technical Editor. Genebase Systems. 2008. Retrieved 2009-11-21.
Haplogroup Q, possibly the youngest of the 20 Y-chromosome haplogroups, originated with the SNP mutation M242 in a man from Haplogroup P that likely lived in Siberia approximately 15,000 to 20,000 years before present
Cite error: The named reference "Genebase" was defined multiple times with different content (see the help page). - ^ a b c Karafet, T. M.; Mendez, F. L.; Meilerman, M. B.; Underhill, P. A.; Zegura, S. L.; Hammer, M. F. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
- ^ Private communication reported between Charles Moore, of ISOGG, and Rebekah Adele Canada, of the FTDNA Y-DNA Q Project.
- ^ "Y-DNA Haplotree". Family Tree DNA uses the Y-Chromosome Consortium tree and posts it on their website.
- ^ Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; Petzlerler, M (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524. doi:10.1086/377588. PMC 1180678. PMID 12900798.
- ^ "Frequency Distribution of Y-DNA Haplogroup Q M3". GeneTree. 2010. Retrieved 2010-01-30.
- ^ "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature Publishing Group. 2010. pp. 463, 757–762. doi:10.1038/nature08835. Retrieved 2010-02-11.
- ^ a b V. N. Kharkov, V. A. Stepanov, O. F. Medvedeva, M. G. Spiridonova, M. I. Voevoda, V. N. Tadinova, and V. P. Puzyrev, "Gene Pool Differences between Northern and Southern Altaians Inferred from the Data on Y-Chromosomal Haplogroups," Genetika (2007), Vol. 43, No. 5, pp. 675–687.
- ^ a b c The Y Chromosome Consortium 2008
- ^ a b c d Gayden T, Cadenas AM, Regueiro M; et al. (2007). "The Himalayas as a Directional Barrier to Gene Flow". Am. J. Hum. Genet. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b c Wen B, Li H, Lu D; et al. (2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031.
Supplementary Table 2: NRY haplogroup distribution in Han populations
{{cite journal}}
: Explicit use of et al. in:|author=
(help); External link in
(help); Unknown parameter|quote=
|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b c d Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; Cavalli-Sforza, Luca (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.
- ^ a b c d Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese: Common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
- ^ a b Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’Jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia: genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–353. doi:10.1007/s00439-006-0213-2. PMID 16845541.
{{cite journal}}
: Cite has empty unknown parameter:|author-name-separator=
(help); Unknown parameter|author-separator=
ignored (help) - ^ a b Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Hum. Hered. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.
{{cite journal}}
: CS1 maint: multiple names: authors list (link) - ^ Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2007). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–126. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
- ^ a b c d e Sanghamitra Sengupta, Lev A. Zhivotovsky, Roy King, S.Q. Mehdi, Christopher A. Edmonds, Cheryl-Emiliane T. Chow, Alice A. Lin, Mitashree Mitra, Samir K. Sil, A. Ramesh, M.V. Usha Rani, Chitra M. Thakur, L. Luca Cavalli-Sforza, Partha P. Majumder, and Peter A. Underhill, "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists," The American Journal of Human Genetics, Volume 78, Issue 2, 202-221, 1 February 2006.
- ^ a b Abu-Amero, Khaled K.; Hellani, Ali; Gonzalez, Ana M.; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10: 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.
{{cite journal}}
: Cite has empty unknown parameter:|author-name-separator=
(help); Unknown parameter|author-separator=
ignored (help)CS1 maint: unflagged free DOI (link) - ^ a b http://www.springerlink.com/content/xvj2jwclptvrvmer/
- ^ Zalloua PA, Xue Y, Khalife J; et al. (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". Am. J. Hum. Genet. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b Cadenas AM, Zhivotovsky LA, Cavalli-Sforza LL, Underhill PA, Herrera RJ (2008). "Y-chromosome diversity characterizes the Gulf of Oman". Eur. J. Hum. Genet. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.
{{cite journal}}
: Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ a b c Cinnioğlu C, King R, Kivisild T; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Hum. Genet. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ . ISBN 978-0-549-80966-1.
{{cite journal}}
: Cite journal requires|journal=
(help); Missing or empty|title=
(help) - ^ Mirabal S, Regueiro M, Cadenas AM; et al. (2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". Eur. J. Hum. Genet. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ Haber M, Platt DE, Ashrafian Bonab M, Youhanna SC, Soria-Hernanz DF, et al. (2012) Afghanistan's Ethnic Groups Share a Y-Chromosomal Heritage Structured by Historical Events. PLoS ONE 7(3): e34288. doi:10.1371/journal.pone.0034288
- ^ Malyarchuk, Boris; Derenko, Miroslava; Denisova, Galina; Maksimov, Arkady; Wozniak, Marcin; Grzybowski, Tomasz; Dambueva, Irina; Zakharov, Ilya (2011). "Ancient links between Siberians and Native Americans revealed by subtyping the Y chromosome haplogroup Q1a". Journal of Human Genetics. 56 (8): 583–8. doi:10.1038/jhg.2011.64. PMID 21677663.
- ^ a b Wells RS, Yuldasheva N, Ruzibakiev R; et al. (2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proc. Natl. Acad. Sci. U.S.A. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236.
Table 1: Y-chromosome haplotype frequencies in 49 Eurasian populations, listed according to geographic region
{{cite journal}}
: Explicit use of et al. in:|author=
(help); External link in
(help); Unknown parameter|quote=
|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ I. Nonaka, K. Minaguchi, and N. Takezaki, "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms," Annals of Human Genetics Volume 71 Issue 4, Pages 480 - 495 (July 2007).
- ^ Zalloua, Pierre A.; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, DE; Royyuru, AK; Herrera, RJ; Hernanz, DF (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". American Journal of Human Genetics. 82 (4): 873–882. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
{{cite journal}}
: Cite has empty unknown parameter:|author-name-separator=
(help); Unknown parameter|author-separator=
ignored (help) - ^ Bortolini MC, Salzano FM, Thomas MG; et al. (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas" (PDF). Am. J. Hum. Genet. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.
{{cite journal}}
: Explicit use of et al. in:|author=
(help); Unknown parameter|month=
ignored (help)CS1 maint: multiple names: authors list (link) - ^ Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; Hillel, Jossi (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852. Q-M323 in 3/20 = 15% of a sample of Yemenite Jews.
- ^ Zhong, H.; Shi, H.; Qi, X.-B.; Duan, Z.-Y.; Tan, P.-P.; Jin, L.; Su, B.; Ma, R. Z. (2010). "Extended Y Chromosome Investigation Suggests Postglacial Migrations of Modern Humans into East Asia via the Northern Route". Molecular Biology and Evolution. 28 (1): 717–27. doi:10.1093/molbev/msq247. PMID 20837606.
- ^ Adams, S. M.; Bosch, E.; Balaresque, P. L.; Ballereau, S. J.; Lee, A. C.; Arroyo, E.; López-Parra, A. M.; Aler, M.; Grifo, M. S.; et al. (2008). "The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula". Am J Hum Genet. 83 (6): 725–736. doi:10.1016/j.ajhg.2008.11.007. PMC 2668061. PMID 19061982.
{{cite journal}}
: Explicit use of et al. in:|first9=
(help)
Bibliography
- Abu-Amero, Khaled K; Hellani, Ali; González, Ana M; Larruga, Jose M; Cabrera, Vicente M; Underhill, Peter A (2009). "Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions". BMC Genetics. 10: 59. doi:10.1186/1471-2156-10-59. PMC 2759955. PMID 19772609.
{{cite journal}}
: CS1 maint: unflagged free DOI (link) - Behar, Doron M.; Garrigan, Daniel; Kaplan, Matthew E.; Mobasher, Zahra; Rosengarten, Dror; Karafet, Tatiana M.; Quintana-Murci, Lluis; Ostrer, Harry; Skorecki, Karl (2004). "Contrasting patterns of Y chromosome variation in Ashkenazi Jewish and host non-Jewish European populations". Human Genetics. 114 (4): 354–65. doi:10.1007/s00439-003-1073-7. PMID 14740294.
- Bortolini, M; Salzano, F; Thomas, M; Stuart, S; Nasanen, S; Bau, C; Hutz, M; Layrisse, Z; Petzlerler, M (2003). "Y-Chromosome Evidence for Differing Ancient Demographic Histories in the Americas". The American Journal of Human Genetics. 73 (3): 524–39. doi:10.1086/377588. PMC 1180678. PMID 12900798.
- Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007). "Y-chromosome diversity characterizes the Gulf of Oman". European Journal of Human Genetics. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.*Cadenas, Alicia M; Zhivotovsky, Lev A; Cavalli-Sforza, Luca L; Underhill, Peter A; Herrera, Rene J (2007). "Y-chromosome diversity characterizes the Gulf of Oman". European Journal of Human Genetics. 16 (3): 374–86. doi:10.1038/sj.ejhg.5201934. PMID 17928816.
- Cinnioglu, Cengiz; King, Roy; Kivisild, Toomas; Kalfoglu, Ersi; Atasoy, Sevil; Cavalleri, Gianpiero L.; Lillie, Anita S.; Roseman, Charles C.; Lin, Alice A. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID 14586639.
- Firasat, Sadaf; Khaliq, Shagufta; Mohyuddin, Aisha; Papaioannou, Myrto; Tyler-Smith, Chris; Underhill, Peter A; Ayub, Qasim (2006). "Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan". European Journal of Human Genetics. 15 (1): 121–6. doi:10.1038/sj.ejhg.5201726. PMC 2588664. PMID 17047675.
- Gayden, T; Cadenas, AM; Regueiro, M; Singh, NB; Zhivotovsky, LA; Underhill, PA; Cavalli-Sforza, LL; Herrera, RJ (2007). "The Himalayas as a Directional Barrier to Gene Flow". The American Journal of Human Genetics. 80 (5): 884–94. doi:10.1086/516757. PMC 1852741. PMID 17436243.
- Hammer, Michael F.; Karafet, Tatiana M.; Park, Hwayong; Omoto, Keiichi; Harihara, Shinji; Stoneking, Mark; Horai, Satoshi (2005). "Dual origins of the Japanese* common ground for hunter-gatherer and farmer Y chromosomes". Journal of Human Genetics. 51 (1): 47–58. doi:10.1007/s10038-005-0322-0. PMID 16328082.
- Mirabal, Sheyla; Regueiro, Maria; Cadenas, Alicia M; Cavalli-Sforza, L Luca; Underhill, Peter A; Verbenko, Dmitry A; Limborska, Svetlana A; Herrera, Rene J (2009). "Y-Chromosome distribution within the geo-linguistic landscape of northwestern Russia". European Journal of Human Genetics. 17 (10): 1260–73. doi:10.1038/ejhg.2009.6. PMC 2986641. PMID 19259129.
- Nonaka, I.; Minaguchi, K.; Takezaki, N. (2007). "Y-chromosomal Binary Haplogroups in the Japanese Population and their Relationship to 16 Y-STR Polymorphisms". Annals of Human Genetics. 71 (Pt 4): 480–95. doi:10.1111/j.1469-1809.2006.00343.x. PMID 17274803.
- Pakendorf, Brigitte; Novgorodov, Innokentij N.; Osakovskij, Vladimir L.; Danilova, Al’Bina P.; Protod’jakonov, Artur P.; Stoneking, Mark (2006). "Investigating the effects of prehistoric migrations in Siberia* genetic variation and the origins of Yakuts". Human Genetics. 120 (3): 334–53. doi:10.1007/s00439-006-0213-2. PMID 16845541.
- Rasmussen, Morten; Li, Yingrui; Lindgreen, Stinus; Pedersen, Jakob Skou; Albrechtsen, Anders; Moltke, Ida; Metspalu, Mait; Metspalu, Ene; Kivisild, Toomas (2010). "Ancient human genome sequence of an extinct Palaeo-Eskimo". Nature. 463 (7282): 757–62. doi:10.1038/nature08835. PMID 20148029.
- Regueiro, M.; Cadenas, A.M.; Gayden, T.; Underhill, P.A.; Herrera, R.J. (2006). "Iran* Tricontinental Nexus for Y-Chromosome Driven Migration". Human Heredity. 61 (3): 132–43. doi:10.1159/000093774. PMID 16770078.
- Sengupta, S; Zhivotovsky, L; King, R; Mehdi, S; Edmonds, C; Chow, C; Lin, A; Mitra, M; Sil, S (2006). "Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists". The American Journal of Human Genetics. 78 (2): 202–21. doi:10.1086/499411. PMC 1380230. PMID 16400607.
- Sharma, Swarkar; Rai, Ekta; Bhat, Audesh K; Bhanwer, Amarjit S; Bamezai, Rameshwar NK (2007). "A novel subgroup Q5 of human Y-chromosomal haplogroup Q in India". BMC Evolutionary Biology. 7: 232. doi:10.1186/1471-2148-7-232. PMC 2258157. PMID 18021436.
{{cite journal}}
: CS1 maint: unflagged free DOI (link) - Shen, Peidong; Lavi, Tal; Kivisild, Toomas; Chou, Vivian; Sengun, Deniz; Gefel, Dov; Shpirer, Issac; Woolf, Eilon; Hillel, Jossi (2004). "Reconstruction of patrilineages and matrilineages of Samaritans and other Israeli populations from Y-Chromosome and mitochondrial DNA sequence Variation". Human Mutation. 24 (3): 248–60. doi:10.1002/humu.20077. PMID 15300852.
- Wells, Spencer. The Journey of Man* A Genetic Odyssey. Random House. ISBN 0-8129-7146-9.
{{cite book}}
:|format=
requires|url=
(help) - Wells, R. S.; Yuldasheva, N; Ruzibakiev, R; Underhill, PA; Evseeva, I; Blue-Smith, J; Jin, L; Su, B; Pitchappan, R (2001). "The Eurasian Heartland: A continental perspective on Y-chromosome diversity". Proceedings of the National Academy of Sciences. 98 (18): 10244–9. doi:10.1073/pnas.171305098. PMC 56946. PMID 11526236.
- Wen, Bo; Li, Hui; Lu, Daru; Song, Xiufeng; Zhang, Feng; He, Yungang; Li, Feng; Gao, Yang; Mao, Xianyun (2004). "Genetic evidence supports demic diffusion of Han culture". Nature. 431 (7006): 302–5. doi:10.1038/nature02878. PMID 15372031.
- Su, Bing; Xiao, Chunjie; Deka, Ranjan; Seielstad, Mark T.; Kangwanpong, Daoroong; Xiao, Junhua; Lu, Daru; Underhill, Peter; Cavalli-Sforza, Luca (2000). "Y chromosome haplotypes reveal prehistorical migrations to the Himalayas". Human Genetics. 107 (6): 582–90. doi:10.1007/s004390000406. PMID 11153912.
- Zalloua, P; Xue, Y; Khalife, J; Makhoul, N; Debiane, L; Platt, D; Royyuru, A; Herrera, R; Hernanz, D (2008). "Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events". The American Journal of Human Genetics. 82 (4): 873–82. doi:10.1016/j.ajhg.2008.01.020. PMC 2427286. PMID 18374297.
- Zegura, S. L.; Karafet, TM; Zhivotovsky, LA; Hammer, MF (2003). "High-Resolution SNPs and Microsatellite Haplotypes Point to a Single, Recent Entry of Native American Y Chromosomes into the Americas". Molecular Biology and Evolution. 21 (1): 164–75. doi:10.1093/molbev/msh009. PMID 14595095.